cbl

Ensembl ID:
ENSDARG00000009958
ZFIN ID:
ZDB-GENE-041114-207
Description:
E3 ubiquitin-protein ligase CBL [Source:RefSeq peptide;Acc:NP_001007331]
Human Orthologue:
CBL
Human Description:
Cas-Br-M (murine) ecotropic retroviral transforming sequence [Source:HGNC Symbol;Acc:1541]
Mouse Orthologue:
Cbl
Mouse Description:
Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35879 Nonsense Mutation detected in F1 DNA During 2016
sa42540 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15300 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006085 Nonsense 176 913 3 16
ENSDART00000130728 Nonsense 176 913 3 17
Genomic Location (Zv9):
Chromosome 15 (position 22597430)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23308617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGGACAACTTCAGAATCACCAAAGCGGATGCCGCAGAGTTCTGGAGA[A/T]GATCGTTCGGGGACAAGTGAGATGCTTCATGTGCTCTTAGTACCCGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006085 Essential Splice Site 511 913 10 16
ENSDART00000130728 Essential Splice Site 511 913 10 17
Genomic Location (Zv9):
Chromosome 15 (position 22609712)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23320899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCCCACCAACCCTCCTGGGGCCTCAAGTCCAGGGGCCACATCCAAGG[T/C]AAATGCTCTAGCGGGGAATGTTTGGTCAAGTTTTCTTCACTTTTGGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006085 Nonsense 645 913 12 16
ENSDART00000130728 Nonsense 645 913 12 17
Genomic Location (Zv9):
Chromosome 15 (position 22610345)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23321532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCTTTATGTGTGCAGAGTTTTGGATCATCRAATCCTGCATCGGATTA[T/G]GACAGTCCAAAAGTAAAGCCGTCTGCCTCGGCTAATGCCATCTATTCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link