cbl

Ensembl ID:
ENSDARG00000009958
ZFIN ID:
ZDB-GENE-041114-207
Description:
E3 ubiquitin-protein ligase CBL [Source:RefSeq peptide;Acc:NP_001007331]
Human Orthologue:
CBL
Human Description:
Cas-Br-M (murine) ecotropic retroviral transforming sequence [Source:HGNC Symbol;Acc:1541]
Mouse Orthologue:
Cbl
Mouse Description:
Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15300 Nonsense Available for shipment Available now
sa3925 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006085 Nonsense 645 913 12 16
ENSDART00000130728 Nonsense 645 913 12 17
Genomic Location:
Chromosome 15 (position 22610345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCTTTATGTGTGCAGAGTTTTGGATCATCRAATCCTGCATCGGATTA[T/G]GACAGTCCAAAAGTAAAGCCGTCTGCCTCGGCTAATGCCATCTATTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006085 Nonsense 863 913 16 16
ENSDART00000130728 Nonsense 863 913 16 17
Genomic Location:
Chromosome 15 (position 22617811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCAGACCCAGTCCAGTTCCCCCCGGGGCGAGTCCAGGCCCCAGCCAG[C/T]AGATCAGCAGTGAGATCGAGCACCTCTTGAGCCAGGGATACTCCCATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r91m2vrw