med14

Ensembl ID:
ENSDARG00000009953
ZFIN ID:
ZDB-GENE-030131-8867
Description:
Mediator complex subunit 14 [Source:UniProtKB/TrEMBL;Acc:Q7ZVB3]
Human Orthologue:
MED14
Human Description:
mediator complex subunit 14 [Source:HGNC Symbol;Acc:2370]
Mouse Orthologue:
Med14
Mouse Description:
mediator complex subunit 14 Gene [Source:MGI Symbol;Acc:MGI:1349442]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34688 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011304 Nonsense 277 604 8 14
ENSDART00000146314 Nonsense 1026 1379 23 29

The following transcripts of ENSDARG00000009953 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35386591)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34606102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGTCTTTGATTTTGTTTTGCAGGAACTCTTGACCCAAGTTCACCATA[C/A]ACACTAGTGTCCGCCAGCCCTAGGGTAGGCCCCTGGCCAGGTTCCCCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link