erc1a

Ensembl ID:
ENSDARG00000009941
ZFIN IDs:
ZDB-GENE-091214-5, ZDB-GENE-091214-5
Description:
ELKS [Source:RefSeq peptide;Acc:NP_001015065]
Human Orthologue:
ERC1
Human Description:
ELKS/RAB6-interacting/CAST family member 1 [Source:HGNC Symbol;Acc:17072]
Mouse Orthologue:
Erc1
Mouse Description:
ELKS/RAB6-interacting/CAST family member 1 Gene [Source:MGI Symbol;Acc:MGI:2151013]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24672 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24673 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012923 Essential Splice Site 355 970 2 17
ENSDART00000041169 Essential Splice Site 355 966 2 16
Genomic Location:
Chromosome 25 (position 21865203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAACCTGCTAGAACAGCGGGATAAAGAGCTGGTGGCTCTCAGAGAG[G/A]TGTGTGACAACTGGAGATGAAACATACATTACAAAATATTACATTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012923 Nonsense 780 970 12 17
ENSDART00000041169 Nonsense 776 966 11 16
Genomic Location:
Chromosome 25 (position 21892356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAACACAAGGAGCCGCCGGGAAAGGGCAGAAATGTCAACGATGGCCCA[C/T]AGCAGGTGAGGTGAACAGAGAGATGGTTATGACAGTTCTGTCTCTTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6h9gdomv