lmnb2

Ensembl ID:
ENSDARG00000009933
ZFIN ID:
ZDB-GENE-990630-13
Description:
lamin-B2 [Source:RefSeq peptide;Acc:NP_571077]
Human Orthologue:
LMNB2
Human Description:
lamin B2 [Source:HGNC Symbol;Acc:6638]
Mouse Orthologue:
Lmnb2
Mouse Description:
lamin B2 Gene [Source:MGI Symbol;Acc:MGI:96796]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8882 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24050 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3163 Nonsense Available for shipment Available now
sa12800 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009438 Essential Splice Site 68 583 1 12
Genomic Location:
Chromosome 22 (position 1220080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGGCTGCAGTTTAAAGTGTCCGAGAAGGAGGAAGTCACGACCAGAGAG[G/A]TGCGTTCCGCTCCTTTGTGTGCGTTTTTATTGATCCATAAATCMACGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009438 Essential Splice Site 381 583 7 12
Genomic Location:
Chromosome 22 (position 1202318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATGGAGATCAACGCCTACAGGAAACTGCTGGAGGGAGAGGAGGACAG[G/A]TGAGCCTCAACACCACACTAAACACCTGCGCTCTTCACAAGACATCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009438 Nonsense 429 583 8 12
Genomic Location:
Chromosome 22 (position 1196055)
KASP Assay ID:
554-2718.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAAGCGTGTGGAGCTGGAGGAGTCATCCACCGCCGGCCCCAAAGTG[C/T]AGATCAGTCAGCAGGCTGAAGCCAGCGGCAGSGTCAGCATTGAGGAGATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009438 Essential Splice Site 496 583 9 12
Genomic Location:
Chromosome 22 (position 1195494)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATAAATTCAGCCCCAAGTTTGTCCTGAAGGCCGGTCAGACAGTTACGG[T/G]AAGCCAATTGGACCAGATCTCGTTAATTTCATGTATTTGAATGACGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/54a4baxb