cadm2a

Ensembl ID:
ENSDARG00000009930
ZFIN ID:
ZDB-GENE-040426-1614
Description:
cell adhesion molecule 2a [Source:RefSeq peptide;Acc:NP_956958]
Human Orthologue:
CADM2
Human Description:
cell adhesion molecule 2 [Source:HGNC Symbol;Acc:29849]
Mouse Orthologue:
Cadm2
Mouse Description:
cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:2442722]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21731 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34900 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4371 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa21731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056369 Essential Splice Site 56 324 2 8
ENSDART00000135475 Essential Splice Site 102 332 2 7
Genomic Location (Zv9):
Chromosome 10 (position 23543677)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23314970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCACCATGCCTGTCAAAACAGCCAAGGCTTTCCTCACCGTCCTGGG[T/C]AAGACATCATTTCATTTACATCCTAATTCAACCAGCTGGAGCGATGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056369 Essential Splice Site 102 324 3 8
ENSDART00000135475 Essential Splice Site 148 332 3 7
Genomic Location (Zv9):
Chromosome 10 (position 23534454)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23305747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTGCGGCTGACGTCCGATGGTTCAAAAATGAGATGGAGGTCAAAGG[T/C]GAGGAAAGCTGGTAAAATATGCGATCATTGAAAGTAAACTTTTAAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4371
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056369 Essential Splice Site 246 324 6 8
ENSDART00000135475 Essential Splice Site 292 332 6 7
Genomic Location (Zv9):
Chromosome 10 (position 23505199)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23276492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAATCACCTCGGCACCAGTCATGCTGAATTCAAACTGGTTATTTATGG[T/G]GAGTGACAGATGGATTACATTAACATGTCTGTTAAGCAAACACAGCCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link