cadm2a

Ensembl ID:
ENSDARG00000009930
ZFIN ID:
ZDB-GENE-040426-1614
Description:
cell adhesion molecule 2a [Source:RefSeq peptide;Acc:NP_956958]
Human Orthologue:
CADM2
Human Description:
cell adhesion molecule 2 [Source:HGNC Symbol;Acc:29849]
Mouse Orthologue:
Cadm2
Mouse Description:
cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:2442722]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21731 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4371 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa21731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056369 Essential Splice Site 56 324 2 8
ENSDART00000135475 Essential Splice Site 102 332 2 7
Genomic Location:
Chromosome 10 (position 23543677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCACCATGCCTGTCAAAACAGCCAAGGCTTTCCTCACCGTCCTGGG[T/C]AAGACATCATTTCATTTACATCCTAATTCAACCAGCTGGAGCGATGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4371
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056369 Essential Splice Site 246 324 6 8
ENSDART00000135475 Essential Splice Site 292 332 6 7
Genomic Location:
Chromosome 10 (position 23505199)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAATCACCTCGGCACCAGTCATGCTGAATTCAAACTGGTTATTTATGG[T/G]GAGTGACAGATGGATTACATTAACATGTCTGTTAAGCAAACACAGCCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0yfhjbh5