ntla

Ensembl ID:
ENSDARG00000009905
ZFIN ID:
ZDB-GENE-980526-437
Description:
Brachyury protein homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q07998]
Human Orthologue:
T
Human Description:
T, brachyury homolog (mouse) [Source:HGNC Symbol;Acc:11515]
Mouse Orthologue:
T
Mouse Description:
brachyury Gene [Source:MGI Symbol;Acc:MGI:98472]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007356 Nonsense 138 423 2 8
Genomic Location (Zv9):
Chromosome 19 (position 30637134)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14328622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCRCCCAACTTCGGCGCGCACTGGATGAAAGCACCCGTATCTTTCAGC[A/T]AAGTCAAACTCTCCAATAAACTYAAYGGAGGAGGRCAGGTAATGATTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association identifies the T gene as a novel asthma pharmacogenetic locus. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link