nadsyn1

Ensembl ID:
ENSDARG00000009903
ZFIN ID:
ZDB-GENE-070615-22
Description:
glutamine-dependent NAD(+) synthetase [Source:RefSeq peptide;Acc:NP_001092723]
Human Orthologue:
NADSYN1
Human Description:
NAD synthetase 1 [Source:HGNC Symbol;Acc:29832]
Mouse Orthologue:
Nadsyn1
Mouse Description:
NAD synthetase 1 Gene [Source:MGI Symbol;Acc:MGI:1926164]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10521 Essential Splice Site Available for shipment Available now
sa32931 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012484 Essential Splice Site 222 564 8 17
Genomic Location (Zv9):
Chromosome 2 (position 27997058)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 28694763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCAAGGCTGATCACAGGGTGAACTTGGTCAAATCTGCCACCACTAAGG[T/C]AAATCATTTTCTGCGTACCAAAGCTTCCTGARTTTGATCTAMAATACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012484 Nonsense 281 564 10 17
Genomic Location (Zv9):
Chromosome 2 (position 28000689)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 28698394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGGAGGTTGTCACAGCAACTCTTGATCTGGAAGATGTGCGCAGTTA[T/A]CGAGGAGAGAGATGTCATCCTCATATGGTATGCAGCATTGAAAAACACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link