
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nadsyn1
- Ensembl ID:
- ENSDARG00000009903
- ZFIN ID:
- ZDB-GENE-070615-22
- Description:
- glutamine-dependent NAD(+) synthetase [Source:RefSeq peptide;Acc:NP_001092723]
- Human Orthologue:
- NADSYN1
- Human Description:
- NAD synthetase 1 [Source:HGNC Symbol;Acc:29832]
- Mouse Orthologue:
- Nadsyn1
- Mouse Description:
- NAD synthetase 1 Gene [Source:MGI Symbol;Acc:MGI:1926164]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10521 | Essential Splice Site | Available for shipment | Available now |
sa32931 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10521
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012484 | Essential Splice Site | 222 | 564 | 8 | 17 |
- Genomic Location (Zv9):
- Chromosome 2 (position 27997058)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 28694763 GRCz11 2 28678794 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCGCAAGGCTGATCACAGGGTGAACTTGGTCAAATCTGCCACCACTAAGG[T/C]AAATCATTTTCTGCGTACCAAAGCTTCCTGARTTTGATCTAMAATACAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32931
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012484 | Nonsense | 281 | 564 | 10 | 17 |
- Genomic Location (Zv9):
- Chromosome 2 (position 28000689)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 28698394 GRCz11 2 28682425 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCAGGAGGTTGTCACAGCAACTCTTGATCTGGAAGATGTGCGCAGTTA[T/A]CGAGGAGAGAGATGTCATCCTCATATGGTATGCAGCATTGAAAAACACCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Vitamin D insufficiency: Common genetic determinants of vitamin D insufficiency: a genome-wide association study. (View Study)
- Vitamin D levels: Genome-wide association study of circulating vitamin D levels. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: