raf1a

Ensembl ID:
ENSDARG00000009875
ZFIN ID:
ZDB-GENE-990415-41
Description:
RAF proto-oncogene serine/threonine-protein kinase [Source:RefSeq peptide;Acc:NP_571514]
Human Orthologue:
RAF1
Human Description:
v-raf-1 murine leukemia viral oncogene homolog 1 [Source:HGNC Symbol;Acc:9829]
Mouse Orthologue:
Raf1
Mouse Description:
v-raf-leukemia viral oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:97847]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37605 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044242 Nonsense 361 643 11 18
ENSDART00000098194 Nonsense 372 654 10 17
ENSDART00000105473   None 248 11 18
ENSDART00000143595   None 187 None 5
Genomic Location (Zv9):
Chromosome 23 (position 4790942)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4800427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTGTGCTACTGAGCAGGATTGGGTCAGGCTCCTTTGGAACCGTACAC[A/T]AAGGGAAATGGCACGGTAAGCATCGGTTTAGTGCTTCTTTCAGTAAAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link