si:ch73-379f5.3

Ensembl ID:
ENSDARG00000009874
ZFIN ID:
ZDB-GENE-091113-2
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39999 Nonsense Mutation detected in F1 DNA During 2017
sa19949 Essential Splice Site Available for shipment Available now
sa31312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059185 Nonsense 40 503 1 9
ENSDART00000143522 Nonsense 47 510 1 9
Genomic Location (Zv9):
Chromosome 3 (position 8857254)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8394721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTTATTTATTTCTTTCTTCTCCAGCTCTCAGGATGAGGGAAAATA[T/A]CCTCCAGGACCCAAACCTCTGCCACTGCTGGGGAACCTGCACATTCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059185 Essential Splice Site 122 503 2 9
ENSDART00000143522 Essential Splice Site 129 510 2 9
Genomic Location (Zv9):
Chromosome 3 (position 8855205)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8392672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACAGAGATATTTCACCCATATTCCACGATTTCAACCAGGGTTATGG[T/A]AAGAGGACTTTCCTATATTTAGATGACTGGTAAATAAACATTTTATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059185 Nonsense 253 503 5 9
ENSDART00000143522 Nonsense 260 510 5 9
Genomic Location (Zv9):
Chromosome 3 (position 8850184)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8387651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGCTAATCAGAAGCGCATTATAAACAACGTCAAAGAAGCCTTTAAA[C/T]AAAGTGGGGAAATAATGAATGGTCTGAAGAACACTCTGAACCCTCAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link