mapk8

Ensembl ID:
ENSDARG00000009870
ZFIN ID:
ZDB-GENE-010202-1
Description:
Mitogen-activated protein kinase 8 [Source:UniProtKB/Swiss-Prot;Acc:Q9DGD9]
Human Orthologue:
MAPK8
Human Description:
mitogen-activated protein kinase 8 [Source:HGNC Symbol;Acc:6881]
Mouse Orthologue:
Mapk8
Mouse Description:
mitogen-activated protein kinase 8 Gene [Source:MGI Symbol;Acc:MGI:1346861]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24900 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022471 None None 384 None 12
ENSDART00000086510 Nonsense 235 260 7 8
ENSDART00000128677 None None 428 None 11
ENSDART00000145213 Nonsense 235 256 7 7
Genomic Location:
Chromosome 12 (position 2776803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGAGGTAGTGTGTTGTTTCCTGGCACAGACCGTATCCTTACCTGGT[T/A]GTCTTTACTGTCCCATTTTAAGTGTTGTCTGTTTGTTTGTTTGTTTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0si4s9ng