dcaf11

Ensembl ID:
ENSDARG00000009868
ZFIN ID:
ZDB-GENE-050809-116
Description:
DDB1- and CUL4-associated factor 11 [Source:RefSeq peptide;Acc:NP_001026845]
Human Orthologue:
DCAF11
Human Description:
DDB1 and CUL4 associated factor 11 [Source:HGNC Symbol;Acc:20258]
Mouse Orthologue:
Dcaf11
Mouse Description:
DDB1 and CUL4 associated factor 11 Gene [Source:MGI Symbol;Acc:MGI:90168]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12275 Essential Splice Site Available for shipment Available now
sa30059 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12157 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002992 Essential Splice Site 163 541 5 15
ENSDART00000131370 Essential Splice Site 155 218 5 7
ENSDART00000133166 Essential Splice Site 155 255 5 8
ENSDART00000133324 Essential Splice Site 163 230 6 8
ENSDART00000002992 Essential Splice Site 163 541 5 15
ENSDART00000131370 Essential Splice Site 155 218 5 7
ENSDART00000133166 Essential Splice Site 155 255 5 8
ENSDART00000133324 Essential Splice Site 163 230 6 8
Genomic Location (Zv9):
Chromosome 24 (position 12881084)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12832532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGTGGGTCAAGTTTCTCTCATGGAGAGTGCAGCCGTATTCGTTCACAG[T/A]AAGTTATGATRCATGCAATGCAACATTGCAATATTTAAATATTTMAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002992 Essential Splice Site 163 541 5 15
ENSDART00000131370 Essential Splice Site 155 218 5 7
ENSDART00000133166 Essential Splice Site 155 255 5 8
ENSDART00000133324 Essential Splice Site 163 230 6 8
ENSDART00000002992 Essential Splice Site 163 541 5 15
ENSDART00000131370 Essential Splice Site 155 218 5 7
ENSDART00000133166 Essential Splice Site 155 255 5 8
ENSDART00000133324 Essential Splice Site 163 230 6 8
Genomic Location (Zv9):
Chromosome 24 (position 12881084)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12832532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGTGGGTCAAGTTTCTCTCATGGAGAGTGCAGCCGTATTCGTTCACAG[T/C]AAGTTATGATGCATGCAATGCAACATTGCAATATTTAAATATTTAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002992 Nonsense 294 541 10 15
ENSDART00000131370   None 218 None 7
ENSDART00000133166   None 255 None 8
ENSDART00000133324   None 230 None 8
Genomic Location (Zv9):
Chromosome 24 (position 12875457)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12826905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGTGCTTTTCATTTTGATTAAACAGTGCAAACGATGGCTGCCTTTA[T/A]GTGTTTGATCGAGAGCAAAACAAAAGAACACTAAAGGTATGGTAAAACYT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link