adssl1

Ensembl ID:
ENSDARG00000009867
ZFIN ID:
ZDB-GENE-040516-18
Description:
Adenylosuccinate synthetase isozyme 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NSN5]
Human Orthologue:
ADSSL1
Human Description:
adenylosuccinate synthase like 1 [Source:HGNC Symbol;Acc:20093]
Mouse Orthologue:
Adssl1
Mouse Description:
adenylosuccinate synthetase like 1 Gene [Source:MGI Symbol;Acc:MGI:87947]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15358 Essential Splice Site Available for shipment Available now
sa11426 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046077 Essential Splice Site 158 456 5 13
ENSDART00000134675 Essential Splice Site 120 193 4 7
Genomic Location:
Chromosome 17 (position 961857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGTGGACGGACTTCAGGAGACTCAAAGACAAGCTCAGGAAGGCAAAAA[G/A]TAAGAACAGAACAAMAGGCTAGTGTATGGCTTGTTRATTTTTGTTNNNAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046077 Essential Splice Site 194 456 6 13
ENSDART00000134675 Essential Splice Site 156 193 5 7
Genomic Location:
Chromosome 17 (position 965882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTTCGCATTTGTGAYCTGATGGCTGATTTCAATGAGTTTTCMACAAG[G/A]TAGATCCTCTRWAAATGCTGAAAAACAAGCATACRTGAGTGCAGTWGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wd0ufao0