ddx55

Ensembl ID:
ENSDARG00000009864
ZFIN ID:
ZDB-GENE-021212-1
Description:
ATP-dependent RNA helicase DDX55 [Source:UniProtKB/Swiss-Prot;Acc:Q8JHJ2]
Human Orthologue:
DDX55
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 [Source:HGNC Symbol;Acc:20085]
Mouse Orthologue:
Ddx55
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 Gene [Source:MGI Symbol;Acc:MGI:1915098]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34815 Nonsense Mutation detected in F1 DNA During 2017
sa41575 Nonsense Mutation detected in F1 DNA During 2017
sa17029 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005168 Nonsense 31 593 1 14

The following transcripts of ENSDARG00000009864 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 3423557)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3415751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTACATGACAACATATTACAGACTCTTAAAGAGCTGGGATTTACATA[T/A]ATGACTCCCGTTCAGGTATTGGATTACTGTTTATACTGTCGCATGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005168 Nonsense 241 593 7 14

The following transcripts of ENSDARG00000009864 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 3419941)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3412135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGAAGGAGAAAGGGGTCGCGGCCTCCAGTGTGCAGAAAACCCCTGCC[A/T]AACTCAGCAACTACTACACCGTGAGTCATTTCTAATCAGCTGTAAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005168 Essential Splice Site 247 593 7 14

The following transcripts of ENSDARG00000009864 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 3419919)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3412113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTCCAGTGTGCAGAAAACCCCTGCCAAACTCAGCAACTACTACACCG[T/G]GAGTCATTTCTAATCAGCKGTAAATCAGAACMGCTGCGTTGATTATGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link