cyp19a1b

Ensembl ID:
ENSDARG00000009852
ZFIN ID:
ZDB-GENE-001103-4
Description:
cytochrome P450, family 19, subfamily A, polypeptide 1b [Source:RefSeq peptide;Acc:NP_571717]
Human Orthologue:
CYP19A1
Human Description:
cytochrome P450, family 19, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2594]
Mouse Orthologue:
Cyp19a1
Mouse Description:
cytochrome P450, family 19, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88587]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24593 Essential Splice Site Available for shipment Available now
sa5094 Nonsense F2 line generated During 2016
sa37992 Nonsense Mutation detected in F1 DNA During 2016
sa37991 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Essential Splice Site 150 511 3 9
ENSDART00000055885 Essential Splice Site 149 400 3 10
ENSDART00000130307 Essential Splice Site 150 511 4 10
Genomic Location (Zv9):
Chromosome 25 (position 4911544)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4772786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGCAACATCGCAAAGTGGAAGAAAGTGAGAACATACTTCACTAAAG[G/C]TGAGTGTTAATCTCTGGTCTCACATCATTTCACACAGAGAATCATCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5094
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Nonsense 381 511 8 9
ENSDART00000055885 Nonsense 349 400 9 10
ENSDART00000130307 Nonsense 381 511 9 10
Genomic Location (Zv9):
Chromosome 25 (position 4908506)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4769748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCATCCGGTGGTGGATTTCATCATGAGGCAGTCTCTGGAGGAYGACTA[C/A]ATTGATGGCTACCGGGTGGCAAAGGGGACAAACCTAATCCTGAACATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Nonsense 407 511 8 9
ENSDART00000055885 Nonsense 375 400 9 10
ENSDART00000130307 Nonsense 407 511 9 10
Genomic Location (Zv9):
Chromosome 25 (position 4908430)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4769672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAAACCTAATCCTGAACATTGGACGCATGCATAAGACAGAGTTCTTC[A/T]AAAAACCCAACGAATTCAGCTTGGAGAACTTCGAGAACACTGTAAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Nonsense 427 511 9 9
ENSDART00000055885   None 400 None 10
ENSDART00000130307 Nonsense 427 511 10 10
Genomic Location (Zv9):
Chromosome 25 (position 4905898)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4767140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAGTCTTATCAACTCTGCCTCCTTCTCAGGTTCCCAGTCGTTACTTC[C/T]AGCCATTCGGTTGTGGTCCGCGGGCCTGTGTTGGGAAGCACATTGCTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Genome-wide association study in Han Chinese identifies three novel loci for human height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • T-tau: Genome-wide association reveals genetic effects on human Aβ42 and τ protein levels in cerebrospinal fluids: a case control study. (View Study)
  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)
  • Thiazide-induced adverse metabolic effects in hypertensive patients: Genome-wide association analyses suggest NELL1 influences adverse metabolic response to HCTZ in African Americans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link