agk

Ensembl ID:
ENSDARG00000009837
ZFIN ID:
ZDB-GENE-030131-6202
Description:
Acylglycerol kinase, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW00]
Human Orthologue:
AGK
Human Description:
acylglycerol kinase [Source:HGNC Symbol;Acc:21869]
Mouse Orthologue:
Agk
Mouse Description:
acylglycerol kinase Gene [Source:MGI Symbol;Acc:MGI:1917173]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9625 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006109 Nonsense 55 422 3 15
Genomic Location:
Chromosome 18 (position 20314136)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCACTACATAANNATATATATTTGGTCTGGTTTCACAGGCATTTGGTCAA[C/T]AGTTAATTGGACCTCAGGAGATTCTGAAGAAAGCCACAGTCATTCTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6njs3av0