hdlbp

Ensembl ID:
ENSDARG00000009830
ZFIN ID:
ZDB-GENE-030131-2032
Description:
vigilin [Source:RefSeq peptide;Acc:NP_958882]
Human Orthologue:
HDLBP
Human Description:
high density lipoprotein binding protein [Source:HGNC Symbol;Acc:4857]
Mouse Orthologues:
4921511C20Rik, Gm382, Hdlbp
Mouse Descriptions:
high density lipoprotein (HDL) binding protein Gene [Source:MGI Symbol;Acc:MGI:99256]
predicted gene 382 Gene [Source:MGI Symbol;Acc:MGI:2685228]
RIKEN cDNA 4921511C20 gene Gene [Source:MGI Symbol;Acc:MGI:2685229]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7582 Missense Mutation detected in F1 DNA During 2014
sa18003 Nonsense Available for shipment Available now
sa14220 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011863 Missense 694 1272 17 28
ENSDART00000055771 Missense 697 1285 15 27
ENSDART00000121511 None None 690 None 18
ENSDART00000134259 None None 433 None 10

The following transcripts of ENSDARG00000009830 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 26592061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCGTGCGTTCCATTATGGAGGAGTGTGGCGGTGTGCACATCCATTTCC[C/A]AACAGAGGGCTCTGGCATCGATGCAGTGACAATCAGAGGCCCAGCGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011863 Nonsense 790 1272 18 28
ENSDART00000055771 Nonsense 793 1285 16 27
ENSDART00000121511 None None 690 None 18
ENSDART00000134259 None None 433 None 10

The following transcripts of ENSDARG00000009830 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 26591570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGAGCTGATCACAGTCATCGGTACAGAGGAAGCTGTCGCAGAAGCA[C/T]AAAAGGAGCTGGAGGCACTTATTAAGAGCTTGGTTAGTGGTTTTGWTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011863 Essential Splice Site 1241 1272 27 28
ENSDART00000055771 Essential Splice Site 1254 1285 26 27
ENSDART00000121511 None None 690 None 18
ENSDART00000134259 None None 433 None 10

The following transcripts of ENSDARG00000009830 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 26585345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGGGCTTTGTTGTGCGGGAGGCTCCTTGGRCTACTGGCAACGAAAAGG[T/A]AAACTAATGTTTTGAGTGTSAAYTATTTATTGTGAAATTAAAAAGCAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nvejrqiv