chmp1a

Ensembl ID:
ENSDARG00000009802
ZFIN ID:
ZDB-GENE-040426-1474
Description:
Charged multivesicular body protein 1a [Source:UniProtKB/Swiss-Prot;Acc:Q6PHF0]
Human Orthologue:
CHMP1B
Human Description:
chromatin modifying protein 1B [Source:HGNC Symbol;Acc:24287]
Mouse Orthologue:
Chmp1a
Mouse Description:
chromatin modifying protein 1A Gene [Source:MGI Symbol;Acc:MGI:1920159]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44367 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024244 Nonsense 196 198 5 6
ENSDART00000081636 Nonsense 196 198 6 7
ENSDART00000122477 Nonsense 196 198 6 7
Genomic Location (Zv9):
Chromosome 25 (position 38448577)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36870635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTACAGGTTGGCTGCTT[T/A]ACGCAACTGATGATCTTCAGATTCACTCAGTCTGTGCTGTTTGGACTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link