crsp7

Ensembl ID:
ENSDARG00000009793
ZFIN ID:
ZDB-GENE-040426-2005
Description:
Mediator of RNA polymerase II transcription subunit 26 [Source:UniProtKB/Swiss-Prot;Acc:Q90YL3]
Human Orthologue:
MED26
Human Description:
mediator complex subunit 26 [Source:HGNC Symbol;Acc:2376]
Mouse Orthologue:
Med26
Mouse Description:
mediator complex subunit 26 Gene [Source:MGI Symbol;Acc:MGI:1917875]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17859 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003801 Essential Splice Site 50 589 3 4
Genomic Location:
Chromosome 2 (position 23302379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAYAYGACTAGTAAAACACATTTTTGAGACTTCCATTTTATTTAAATGC[A/T]GGAAACCCGCTTGGGAAAGCTAATTAACGATGTGAGAAAGAAAACAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7t2lhuy1