dirc2

Ensembl ID:
ENSDARG00000009783
ZFIN ID:
ZDB-GENE-040912-167
Description:
disrupted in renal carcinoma 2 [Source:RefSeq peptide;Acc:NP_001004597]
Human Orthologue:
DIRC2
Human Description:
disrupted in renal carcinoma 2 [Source:HGNC Symbol;Acc:16628]
Mouse Orthologue:
Dirc2
Mouse Description:
disrupted in renal carcinoma 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2387188]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34701 Nonsense Available for shipment Available now
sa13846 Essential Splice Site Available for shipment Available now
sa21541 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016370 Nonsense 207 466 3 9
Genomic Location (Zv9):
Chromosome 9 (position 38439698)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37577594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCCCTGCACCCAATGACACTGAGAAATTGGGAAACGTCATCTACTG[G/A]AACCAAAACCACATAGGAAACAGGATACAGTTTGTTCTTTACACAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016370 Essential Splice Site 266 466 5 9
Genomic Location (Zv9):
Chromosome 9 (position 38454755)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37592651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGTGCTAAAATGTCTCATCAGTTTTCATCTTTGCTTTTGCTTTTKCA[G/A]CAACATGCGTTTCCTGATGATAGCACTCGCCTACTCCGTGCCCACAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016370 Nonsense 433 466 9 9
Genomic Location (Zv9):
Chromosome 9 (position 38503800)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37641696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTAACCCCGATCACCCTTGCTATTTTGTTTTTCAGAGCTGTCCTGGT[T/A]GAACTGGTGTCTGACAGGATCCTGCATCTTCAGTCTCCTGCTCCTCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link