myh11a

Ensembl ID:
ENSDARG00000009782
ZFIN ID:
ZDB-GENE-050531-1
Description:
myosin-11 [Source:RefSeq peptide;Acc:NP_001019619]
Human Orthologue:
MYH11
Human Description:
myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
Mouse Orthologue:
Myh11
Mouse Description:
myosin, heavy polypeptide 11, smooth muscle Gene [Source:MGI Symbol;Acc:MGI:102643]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20640 Nonsense Mutation detected in F1 DNA During 2014
sa11268 Nonsense Available for shipment Available now
sa15692 Essential Splice Site Available for shipment Available now
sa7029 Nonsense Mutation detected in F1 DNA During 2014
sa20641 Nonsense Mutation detected in F1 DNA During 2014
sa16962 Nonsense Available for shipment Available now
sa16661 Essential Splice Site Available for shipment Available now
sa20642 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Nonsense 29 1974 2 41
ENSDART00000138858 Nonsense 29 133 2 3
Genomic Location:
Chromosome 6 (position 9227144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCACGGACAAAGACTTCATCAACAGCCCCGTGGCCCAGGCCGATTG[G/A]TCAGCCAAAAAGCTGGTGTGGGTCCCCTCCGAAAAGCACGGCTTCGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Nonsense 427 1974 12 41
ENSDART00000138858 None None 133 None 3
Genomic Location:
Chromosome 6 (position 9260748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTMCCATTACAGGCTGATTTTGCCATTGAAGCTTTAGCTAAAGCTATGTA[C/A]GAACGCTTGTTYCGTTGGATCCTTCTAAGAGTCAACAAAGCGTTAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Essential Splice Site 684 1974 16 41
ENSDART00000138858 None None 133 None 3
Genomic Location:
Chromosome 6 (position 9263120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACAGCCAAACTTTGTCCGCTGTATTATCCCCAACCATGAGAAACGG[G/A]TATATTGCCATCRTATTAGAWACCAAAAGTGGTGGTACAAANTCTTTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Nonsense 726 1974 18 41
ENSDART00000138858 None None 133 None 3
Genomic Location:
Chromosome 6 (position 9264573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATAGTAAGGTTAAAAACNAKTTTGCATTTACATATTGACATACAGATA[T/A]GAGATCCTGGCAGCGAATGCTATTCCAAAAGGCTTCATGGATGGCAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Nonsense 1197 1974 27 41
ENSDART00000138858 None None 133 None 3
Genomic Location:
Chromosome 6 (position 9272369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATAGAGGACGAGAGCCGCGTCCATGAGGCTCAGGTGCAGGAGATGAGA[C/T]AGAAACACACCCAAGCTTTGGAGGAGCTCACAGAGCAACTGGAGCAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Nonsense 1316 1974 29 41
ENSDART00000138858 None None 133 None 3
Genomic Location:
Chromosome 6 (position 9274360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGAACATAAAGCTTAGYAAGGATGTGGCTAGCTTGAGTTCTCAAGTT[C/T]AAGACACWCAGGTATGAGGGTCAAAAACGAGACATCTTATTTTGGTGTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Essential Splice Site 1524 1974 32 41
ENSDART00000138858 None None 133 None 3
Genomic Location:
Chromosome 6 (position 9277233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGAAATGGAGGATCTAGTCAGCTCCAAAGACGAYGTRGGCAAAAACG[T/G]AAGTTCAGYAGTGTAARGGAAAATTTGAAACATTCCTTGCATTGGAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041142 Nonsense 1762 1974 37 41
ENSDART00000138858 None None 133 None 3
Genomic Location:
Chromosome 6 (position 9282272)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCAAGGCAACATGGAGATGCTCAATGACAGGCTGAGAAAGAGCGCA[C/T]AGCAGGTACATGCGTTACAGTACATCAAATAGACATTAATATTAGGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s80x6322