mcl1a

Ensembl ID:
ENSDARG00000009779
ZFIN ID:
ZDB-GENE-000511-7
Description:
myeloid cell leukemia sequence 1a [Source:RefSeq peptide;Acc:NP_571674]
Human Orthologue:
MCL1
Human Description:
myeloid cell leukemia sequence 1 (BCL2-related) [Source:HGNC Symbol;Acc:6943]
Mouse Orthologue:
Mcl1
Mouse Description:
myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12089 Nonsense Available for shipment Available now
sa10132 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114284 Nonsense 119 255 1 3
Genomic Location:
Chromosome 19 (position 359123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGTGTCCGGTAGACCGTAAACTCCATCACGCCATACCGACGATGAAG[C/T]GAGTGGTCGACAAWATTCTCGTDAAGCACCAGATCGCATACAAMGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114284 Nonsense 119 255 1 3
Genomic Location:
Chromosome 19 (position 359123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGTGTCCGGTAGACCGTAAACTCCATCACGCCATACCGACGATGAAG[C/T]GAGTGGTCGACAAWATTCTCGTDAAGCACCAGATCGCATACAAMGGTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies a new melanoma susceptibility locus at 1q21.3. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z49ygbmu