ppme1

Ensembl ID:
ENSDARG00000009771
ZFIN ID:
ZDB-GENE-030131-7064
Description:
protein phosphatase methylesterase 1 [Source:RefSeq peptide;Acc:NP_956231]
Human Orthologue:
PPME1
Human Description:
protein phosphatase methylesterase 1 [Source:HGNC Symbol;Acc:30178]
Mouse Orthologue:
Ppme1
Mouse Description:
protein phosphatase methylesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1919840]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15990 Essential Splice Site Available for shipment Available now
sa43649 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37316 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016219 Essential Splice Site 92 377 3 14
Genomic Location (Zv9):
Chromosome 21 (position 24668991)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25354665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCTGCATGGAGGAGGTCACTCTGCTCTKTCCTGGGCCGTCTTTACTG[T/G]GAGTTTAATATMTCTCTCAAAGYCACACATGAATACAAGCATAATATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016219 Essential Splice Site 355 377 12 14
ENSDART00000016219 Essential Splice Site 355 377 12 14
Genomic Location (Zv9):
Chromosome 21 (position 24661113)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25346787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCTGCCACAATGTGGCCATGCCGTTCATGAAGATGCCCCAGAAAAAG[T/A]GTGTTTATTATCTATGACACTTTCAATAAAGCTTGTACATTATCCAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016219 Essential Splice Site 355 377 12 14
ENSDART00000016219 Essential Splice Site 355 377 12 14
Genomic Location (Zv9):
Chromosome 21 (position 24661113)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25346787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCTGCCACAATGTGGCCATGCCGTTCATGAAGATGCCCCAGAAAAAG[T/A]GTGTTTATTATCTATGACACTTTCAATAAAGCTTGTACATTATCCAGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link