fbxw2

Ensembl ID:
ENSDARG00000009745
ZFIN ID:
ZDB-GENE-050522-303
Description:
F-box/WD repeat-containing protein 2 [Source:RefSeq peptide;Acc:NP_001018175]
Human Orthologue:
FBXW2
Human Description:
F-box and WD repeat domain containing 2 [Source:HGNC Symbol;Acc:13608]
Mouse Orthologue:
Fbxw2
Mouse Description:
F-box and WD-40 domain protein 2 Gene [Source:MGI Symbol;Acc:MGI:1353435]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33642 Nonsense Mutation detected in F1 DNA During 2016
sa8382 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023977 Nonsense 299 455 5 7
ENSDART00000141294 Nonsense 51 141 2 3

The following transcripts of ENSDARG00000009745 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 34020818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATGATGCACAGTCCTGGTGACTACATACTACTGAGTGTTGATAAATA[T/A]GAAATAAAGGTAATGCATGCCATTTTTAAGAACCAAAGTGTTTTGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023977 Nonsense 451 455 7 7
ENSDART00000141294   None 141 None 3

The following transcripts of ENSDARG00000009745 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 34019013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTGTTTGCCACSAGTATGCCTGACCATAGCATTCATCTGGTTCTCTG[G/A]AGAGAGAATGGCTAGGACATGGAGGAGGCAAATACTAGCCCTGTGCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link