efhc1

Ensembl ID:
ENSDARG00000009743
ZFIN ID:
ZDB-GENE-040426-1300
Description:
EF-hand domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_957261]
Human Orthologue:
EFHC1
Human Description:
EF-hand domain (C-terminal) containing 1 [Source:HGNC Symbol;Acc:16406]
Mouse Orthologue:
Efhc1
Mouse Description:
EF-hand domain (C-terminal) containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919127]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3106 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25146 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023058 Essential Splice Site 21 554 1 10
Genomic Location:
Chromosome 20 (position 47881923)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGACACGGWCTTCCTTTCCTGCCAGGAAACACATTTCGCGATTTAACG[G/T]TAAGAGTTTTAAACCGTGTAAGCMCGTATTATCTKCTAACTAGGCCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023058 Essential Splice Site 95 554 2 10
Genomic Location:
Chromosome 20 (position 47880202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTGCCACTAGAGTTCATACCGGCACACGCTGCTTATGACAAGAAGG[T/C]GAAGATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gdrp639f