efhc1

Ensembl ID:
ENSDARG00000009743
ZFIN ID:
ZDB-GENE-040426-1300
Description:
EF-hand domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_957261]
Human Orthologue:
EFHC1
Human Description:
EF-hand domain (C-terminal) containing 1 [Source:HGNC Symbol;Acc:16406]
Mouse Orthologue:
Efhc1
Mouse Description:
EF-hand domain (C-terminal) containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919127]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25146 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023058 Essential Splice Site 95 554 2 10
Genomic Location (Zv9):
Chromosome 20 (position 47880202)
KASP Assay ID:
554-7899.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTGCCACTAGAGTTCATACCGGCACACGCTGCTTATGACAAGAAGG[T/C]GAAGATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link