ppp1r7

Ensembl ID:
ENSDARG00000009740
ZFIN ID:
ZDB-GENE-051113-288
Description:
Protein phosphatase 1 regulatory subunit 7 [Source:UniProtKB/Swiss-Prot;Acc:Q32PL1]
Human Orthologue:
PPP1R7
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 7 [Source:HGNC Symbol;Acc:9295]
Mouse Orthologue:
Ppp1r7
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1913635]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39803 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022356 Essential Splice Site 258 345 8 10
Genomic Location (Zv9):
Chromosome 2 (position 16523871)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17034230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTTGAGTCATAATGGCATTGAAGTCATGGAGGGTCTGGAGAACAATG[T/C]AAGATCTGCAACTCCTGTCAATTCAAAATGTGTCTAAAAGATGATTGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link