cacnb4a

Ensembl ID:
ENSDARG00000009738
ZFIN ID:
ZDB-GENE-080320-2
Description:
voltage-dependent L-type calcium channel subunit beta-4 [Source:RefSeq peptide;Acc:NP_001106991]
Human Orthologue:
CACNB4
Human Description:
calcium channel, voltage-dependent, beta 4 subunit [Source:HGNC Symbol;Acc:1404]
Mouse Orthologue:
Cacnb4
Mouse Description:
calcium channel, voltage-dependent, beta 4 subunit Gene [Source:MGI Symbol;Acc:MGI:103301]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34703 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017833 Nonsense 511 519 14 14
ENSDART00000123749 Nonsense 477 485 13 13
ENSDART00000135314 Nonsense 490 498 13 13
Genomic Location (Zv9):
Chromosome 9 (position 39181627)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38319523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCAGACGCCTACAAACCCCACCGCAACCGGGGCTCTCCAGGCGGCTA[C/A]AGCAACGATTCACGCCACAGACTCTAAACATCACAATATTGTGTACATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link