LOC570502

Ensembl ID:
ENSDARG00000009733
Human Orthologue:
KIF21B
Human Description:
kinesin family member 21B [Source:HGNC Symbol;Acc:29442]
Mouse Orthologue:
Kif21b
Mouse Description:
kinesin family member 21B Gene [Source:MGI Symbol;Acc:MGI:109234]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15402 Nonsense Available for shipment Available now
sa16362 Essential Splice Site Available for shipment Available now
sa13339 Nonsense Available for shipment Available now
sa21831 Nonsense Mutation detected in F1 DNA During 2014
sa3785 Nonsense Mutation detected in F1 DNA During 2014
sa6188 Nonsense Mutation detected in F1 DNA During 2014
sa21832 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10974 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Nonsense 60 1237 2 24
Genomic Location:
Chromosome 11 (position 2881723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAGATAAAGCCTTCACGTATGACTTTGTRTTTGACCTGGATGCTCAT[C/T]AGCAGCAGATCTACAGCGCCTGCGTTCACAAGCTCATCGAGGGCTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Essential Splice Site 199 1237 4 24
Genomic Location:
Chromosome 11 (position 2884907)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTACACCACTGGAGTGACCTCACGACTGGYCAGCTCAGAGGACGAGG[T/C]CAGATTGCCTTGTTTTGTTGTCTGAGCAYKAAAAGAATTCAAATTGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Nonsense 383 1237 8 24
Genomic Location:
Chromosome 11 (position 2893401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCCGCAACATCAAGAACAAGGTGATCGTCAACCAGGATAAAACCAGC[C/T]AGCAGATCAGCGCGTTACGAGCCGAGATCGCACGACTACAGATGGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Nonsense 389 1237 8 24
Genomic Location:
Chromosome 11 (position 2893419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGGTGATCGTCAACCAGGATAAAACCAGCCAGCAGATCAGCGCGTTA[C/T]GAGCCGAGATCGCACGACTACAGATGGAGATCATGGAGTATAAAGCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Nonsense 437 1237 9 24
Genomic Location:
Chromosome 11 (position 2894658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCAGGAGAACTCGATGCTCCAGAGAGAGAATGACACTCTTCGAATG[C/T]GAGTTAAAGCCATGCAGGAAACCATCGACCATCTCAATACTCGMGTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Nonsense 722 1237 15 24
Genomic Location:
Chromosome 11 (position 2902298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNATGAAATAGTTCCTCTTTTTGAMTMATTTGTTTTTTAGTGT[C/A]GATGGAGAACTACACTGAAGAGAAAGCCAGTAAGGTGAAGTCYGAGTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Essential Splice Site 977 1237 19 24
Genomic Location:
Chromosome 11 (position 2908286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGAAAGCAGTTACCGTCCCATGCCTAGTCCTGATGATGTGTTGTGTCC[A/G]GAAACGCGAGGAGCTCTCAGTGCAGCAGGAGGCGCTGCTGCGTAAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093108 Nonsense 1133 1237 21 24
Genomic Location:
Chromosome 11 (position 2909712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGCGGAGTGCATCCCTGAACTGCAGGCTTTAATCCATAATKTCCAA[C/T]AAGGTGAAGATTCACTTTCATTTTAGTTAATTGTGTTTCAAATAGGGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6dawke8c