LOC560440

Ensembl ID:
ENSDARG00000009702

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5442 Nonsense Mutation detected in F1 DNA During 2016
sa41003 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38638 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126991 Nonsense 66 829 2 10
Genomic Location:
Chromosome 7 (position 51154359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATATCTCACAACTTACAAACCTCAAAGAGCTCAACCTGAGCAGAAAT[G/T]AGATCACCGACTTTCCTGTGGAGATTAGAGCATTACGCCAACTCAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126991 Essential Splice Site 460 829 5 10
Genomic Location:
Chromosome 7 (position 51160648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGCAGTACATATTGTGCCTTTCTTAATTCTTAAATGTGCACCTTAAC[A/C]GGTGTTGTGAGTCAAGATGTCCTCTTGTGTGAACTGAAGAACAGGCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126991 Nonsense 825 829 9 10
Genomic Location:
Chromosome 7 (position 51170091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCACATGCCGTAATGGACACCAGCGAAGGACAGAGTTGCTGTTCCCC[A/T]GAAGTAAATGCTTTCATTTAGAGAAATACAACAAACCTTTATTGTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link