llgl1

Ensembl ID:
ENSDARG00000009693
ZFIN ID:
ZDB-GENE-060825-69
Description:
lethal giant larvae homolog 1 [Source:RefSeq peptide;Acc:NP_001038934]
Human Orthologue:
LLGL1
Human Description:
lethal giant larvae homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:6628]
Mouse Orthologue:
Llgl1
Mouse Description:
lethal giant larvae homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102682]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11111 Nonsense Available for shipment Available now
sa31349 Nonsense Mutation detected in F1 DNA During 2016
sa8141 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003511 Nonsense 144 1045 5 24
ENSDART00000102540 Nonsense 144 304 5 8
ENSDART00000146121 Nonsense 144 305 5 8
ENSDART00000146700 Nonsense 117 1014 4 22
Genomic Location:
Chromosome 3 (position 40009498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTTTGTAGTGCAACTCGTGTGACGGTCATGCTGCTGAATCTGAGCTG[T/A]AATCTTCTCGCTCTGGGGACTGAAGGTGGTGGGGTTCACTTTCTGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003511 Nonsense 278 1045 7 24
ENSDART00000102540 Nonsense 277 304 7 8
ENSDART00000146121 Nonsense 278 305 7 8
ENSDART00000146700 Nonsense 251 1014 6 22
Genomic Location:
Chromosome 3 (position 39998223)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAGCAATCCCTGCACCCATGACCCCGTCTCATCCACTATACCATA[T/A]GGTGAGCCTTAACACATACCAATTACACACTGGCTTTCCTTTTTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003511 Essential Splice Site 531 1045 13 24
ENSDART00000102540   None 304 None 8
ENSDART00000146121   None 305 None 8
ENSDART00000146700 Essential Splice Site 503 1014 12 22
Genomic Location:
Chromosome 3 (position 39987140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTGTAAATACAGYGGAAAACTGGTGGTGGCTGGAACTGCTGGACAA[G/A]TAGGGAATGCTATTAGTGTTGTTGTYATTTGTTAAYGCAAATGTATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link