llgl1

Ensembl ID:
ENSDARG00000009693
ZFIN ID:
ZDB-GENE-060825-69
Description:
lethal giant larvae homolog 1 [Source:RefSeq peptide;Acc:NP_001038934]
Human Orthologue:
LLGL1
Human Description:
lethal giant larvae homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:6628]
Mouse Orthologue:
Llgl1
Mouse Description:
lethal giant larvae homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102682]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11111 Nonsense Available for shipment Available now
sa8141 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003511 Nonsense 144 1045 5 24
ENSDART00000102540 Nonsense 144 304 5 8
ENSDART00000146121 Nonsense 144 305 5 8
ENSDART00000146700 Nonsense 117 1014 4 22
Genomic Location:
Chromosome 3 (position 40009498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTTTGTAGTGCAACTCGTGTGACGGTCATGCTGCTGAATCTGAGCTG[T/A]AATCTTCTCGCTCTGGGGACTGAAGGTGGTGGGGTTCACTTTCTGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003511 Essential Splice Site 531 1045 13 24
ENSDART00000102540 None None 304 None 8
ENSDART00000146121 None None 305 None 8
ENSDART00000146700 Essential Splice Site 503 1014 12 22
Genomic Location:
Chromosome 3 (position 39987140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTGTAAATACAGYGGAAAACTGGTGGTGGCTGGAACTGCTGGACAA[G/A]TAGGGAATGCTATTAGTGTTGTTGTYATTTGTTAAYGCAAATGTATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z4lst3xz