daam1b

Ensembl ID:
ENSDARG00000009689
ZFIN ID:
ZDB-GENE-030131-4212
Description:
si:ch211-87i20.1 [Source:RefSeq peptide;Acc:NP_001025307]
Human Orthologue:
DAAM1
Human Description:
dishevelled associated activator of morphogenesis 1 [Source:HGNC Symbol;Acc:18142]
Mouse Orthologue:
Daam1
Mouse Description:
dishevelled associated activator of morphogenesis 1 Gene [Source:MGI Symbol;Acc:MGI:1914596]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32288 Nonsense Available for shipment Available now
sa300 Nonsense F2 line generated During 2017
sa23682 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004984 Nonsense 132 1079 4 25
ENSDART00000109084 Nonsense 132 1069 4 24

The following transcripts of ENSDARG00000009689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21951975)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21980142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAGACTCTGTTGGCCTTGGAGAAGGAAGAAGAGGAGGAACGCAAC[A/T]AGACCATTGAAAGCCTTAAAACGGCACTGCGAACACAACCCATGAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa300
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004984 Nonsense 485 1079 12 25
ENSDART00000109084 Nonsense 485 1069 12 24
ENSDART00000004984 Nonsense 485 1079 12 25
ENSDART00000109084 Nonsense 485 1069 12 24

The following transcripts of ENSDARG00000009689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21937474)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21965641
KASP Assay ID:
554-3271.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGAGCGAGAGTGTGACGCCAAAACACAGGAGAAGGAGGAGATGATG[C/T]AGACCCTCAACAAGATGAAAGAGAAGTTAGAAAGAGAAATGGGGGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004984 Essential Splice Site 953 1079 24 25
ENSDART00000109084 Essential Splice Site 943 1069 23 24

The following transcripts of ENSDARG00000009689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21891309)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21919476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATTTATGTTGAAAATGGCTCTCATACGAGTTCTGCTTCTGTTCTCTA[G/A]TTCATCAAGACAGTCAAGCACTTCGGTGAGGACGCTGATAAGATGCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link