ppa2

Ensembl ID:
ENSDARG00000009685
ZFIN ID:
ZDB-GENE-040426-1857
Description:
inorganic pyrophosphatase 2, mitochondrial [Source:RefSeq peptide;Acc:NP_991225]
Human Orthologue:
PPA2
Human Description:
pyrophosphatase (inorganic) 2 [Source:HGNC Symbol;Acc:28883]
Mouse Orthologue:
Ppa2
Mouse Description:
pyrophosphatase (inorganic) 2 Gene [Source:MGI Symbol;Acc:MGI:1922026]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6589 Nonsense Mutation detected in F1 DNA During 2017
sa24846 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023904 Nonsense 43 250 5 12
ENSDART00000123826 Nonsense 132 339 5 12
ENSDART00000142198 Nonsense 94 218 6 9
ENSDART00000145512   None 112 None 6
ENSDART00000146312 Nonsense 94 282 5 10

The following transcripts of ENSDARG00000009685 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25277757)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25701455
KASP Assay ID:
554-4869.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGGAACCATTAAACCCAATCAGGCAAGATGTAAAGAAAGGCAAGCTA[C/T]GATATGTAGCTAATGTTTTTCCACACAAAGGATACATTTGGAACTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023904 Nonsense 58 250 5 12
ENSDART00000123826 Nonsense 147 339 5 12
ENSDART00000142198 Nonsense 109 218 6 9
ENSDART00000145512   None 112 None 6
ENSDART00000146312 Nonsense 109 282 5 10

The following transcripts of ENSDARG00000009685 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25277710)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25701408
KASP Assay ID:
554-7760.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGATATGTAGCTAATGTTTTTCCACACAAAGGATACATTTGGAACTA[T/A]GGTGCACTTCCACAGGTGATGTTCTGTTTTTGCAAAAAAAAAAAAAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link