dlg1

Ensembl ID:
ENSDARG00000009677
ZFIN ID:
ZDB-GENE-010724-8
Description:
Disks large homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5PYH6]
Human Orthologue:
DLG1
Human Description:
discs, large homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2900]
Mouse Orthologue:
Dlg1
Mouse Description:
discs, large homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:107231]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14850 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024906   None 873 None 25
ENSDART00000028406 Nonsense 635 909 16 25
ENSDART00000139891   None 709 None 21
ENSDART00000143334 Nonsense 437 697 11 19

The following transcripts of ENSDARG00000009677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 29774126)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30069769
KASP Assay ID:
1641-0479.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGATATCCTRCACGTYCTCAATGCCTCAGACGAGGAGTGGTGGCAAGCA[C/T]GACATGTGACCACAGATGGCGAGATGGAGGAGATGGGCGTCATTCCCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link