si:ch211-197g15.5

Ensembl ID:
ENSDARG00000009673
ZFIN ID:
ZDB-GENE-050208-536
Description:
LOC555512 proteinNovel protein containing a TLD domain [Source:UniProtKB/TrEMBL;Acc:Q1LVY9]
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24141 Nonsense Available for shipment Available now
sa19288 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105460 Nonsense 20 479 1 8
Genomic Location (Zv9):
Chromosome 22 (position 17723534)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17474469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTATCTTCTGCTTTGGTGTACAGTACGAATACCTTGCGGGATTTCATA[T/A]AAGCCTACAACGAACAGGTCTGCTATAAAGGTAAGCATAATGTAGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105460 Nonsense 115 479 2 8
Genomic Location (Zv9):
Chromosome 22 (position 17722788)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17473723
KASP Assay ID:
2261-6693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTATATCTTTGGTGGATACACTAGTGTACATTATGCTCAAAGTGGG[C/T]AATATCTTGCTGACAACGAAGCTTTCCTGTTCACCTTTCAAGGCAAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link