fgfr1op2

Ensembl ID:
ENSDARG00000009657
ZFIN ID:
ZDB-GENE-030131-7451
Description:
FGFR1 oncogene partner 2 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7T338]
Human Orthologue:
FGFR1OP2
Human Description:
FGFR1 oncogene partner 2 [Source:HGNC Symbol;Acc:23098]
Mouse Orthologue:
Fgfr1op2
Mouse Description:
FGFR1 oncogene partner 2 Gene [Source:MGI Symbol;Acc:MGI:1914779]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1166 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa1166
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021139 Nonsense 116 215 4 6

The following transcripts of ENSDARG00000009657 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 1585825)
KASP Assay ID:
554-1076.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCATGAGCAAATACAGAGAGCAAGTGTTTCGACTTCTGAKGGCCAGC[A/T]AAAAAGAGGATCCCACCATCGTCACGCAGCTCAGAGAACAGCACACGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t79e9uw6