psmb1

Ensembl ID:
ENSDARG00000009640
ZFIN ID:
ZDB-GENE-040618-2
Description:
proteasome subunit beta type-1 [Source:RefSeq peptide;Acc:NP_001003889]
Human Orthologue:
PSMB1
Human Description:
proteasome (prosome, macropain) subunit, beta type, 1 [Source:HGNC Symbol;Acc:9537]
Mouse Orthologue:
Psmb1
Mouse Description:
proteasome (prosome, macropain) subunit, beta type 1 Gene [Source:MGI Symbol;Acc:MGI:104884]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35392 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007231 Nonsense 131 237 4 6
Genomic Location (Zv9):
Chromosome 13 (position 1017978)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1015786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGTCCACCATTCTGTACGGCAGGCGCTTCTTCCCTTACTACGTCTA[C/A]AACATCATCGGCGGTCTGGATGAGGAGGGTGAGTTCGCTCAGGTCTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link