CACNG2 (2 of 2)

Ensembl ID:
ENSDARG00000009621
Description:
calcium channel, voltage-dependent, gamma subunit 2 [Source:HGNC Symbol;Acc:1406]
Human Orthologue:
CACNG2
Human Description:
calcium channel, voltage-dependent, gamma subunit 2 [Source:HGNC Symbol;Acc:1406]
Mouse Orthologue:
Cacng2
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1316660]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5343 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013939 Essential Splice Site 99 323 3 5
Genomic Location:
Chromosome 6 (position 309334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGCACCCATCCCGTCCTGAGCTGGGATCGARCCCACAATTCTTTGTA[C/T]GCACCTTTACAGGTCAGAGGAGTGAGGCGCTAGCTGCCCTCCGTTACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lhdz2q3l