ccnc

Ensembl ID:
ENSDARG00000009607
ZFIN ID:
ZDB-GENE-030131-7369
Description:
cyclin-C [Source:RefSeq peptide;Acc:NP_956245]
Human Orthologue:
CCNC
Human Description:
cyclin C [Source:HGNC Symbol;Acc:1581]
Mouse Orthologue:
Ccnc
Mouse Description:
cyclin C Gene [Source:MGI Symbol;Acc:MGI:1858199]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38422 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021753 Nonsense 73 283 3 12
Genomic Location (Zv9):
Chromosome 4 (position 5646772)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5764953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGACAGCAGGTCATCGCCACGGCAACTGTCTACTTTAAGCGTTTCTA[T/A]GCCAGGTGAGCAGTGCAGTGCCGTCATTAAAAGCTTGTTTTCTTCTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link