nr1d2b

Ensembl ID:
ENSDARG00000009594
ZFIN ID:
ZDB-GENE-990415-244
Description:
nuclear receptor subfamily 1 group D member 2 [Source:RefSeq peptide;Acc:NP_571140]
Human Orthologue:
NR1D2
Human Description:
nuclear receptor subfamily 1, group D, member 2 [Source:HGNC Symbol;Acc:7963]
Mouse Orthologue:
Nr1d2
Mouse Description:
nuclear receptor subfamily 1, group D, member 2 Gene [Source:MGI Symbol;Acc:MGI:2449205]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36820 Nonsense Mutation detected in F1 DNA During 2017
sa5921 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127353 Nonsense 67 578 2 8

The following transcripts of ENSDARG00000009594 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19390480)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17943615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGTGGCCTCTCATTCTCGCCCACCAAGGCATGGTGGAGGGAAAGCA[C/T]GATCACTCTCCTCCACCAAAAGTGGCATTACAAGTAAGTGACTATATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127353 Nonsense 311 578 5 8

The following transcripts of ENSDARG00000009594 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19392567)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17945702
KASP Assay ID:
554-3777.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTCAGGAGGTCTTGAACYACCAGAACAATGTGTCCTCAGTAAGTGAA[C/T]AGAATCCACAGTCGAGCTGTGGTCCACAGGGTCCTGAAGACTCTGGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link