papolb

Ensembl ID:
ENSDARG00000009585
ZFIN ID:
ZDB-GENE-030131-3507
Description:
poly(A) polymerase alpha [Source:RefSeq peptide;Acc:NP_991321]
Human Orthologues:
PAPOLA, PAPOLB
Human Descriptions:
poly(A) polymerase alpha [Source:HGNC Symbol;Acc:14981]
poly(A) polymerase beta (testis specific) [Source:HGNC Symbol;Acc:15970]
Mouse Orthologues:
Papola, Papolb
Mouse Descriptions:
poly (A) polymerase alpha Gene [Source:MGI Symbol;Acc:MGI:109301]
poly (A) polymerase beta (testis specific) Gene [Source:MGI Symbol;Acc:MGI:1932115]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36953 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050201   None 385 None 13
ENSDART00000053858 Nonsense 720 723 23 23
ENSDART00000104540 Nonsense 720 723 23 23
ENSDART00000124199   None 436 None 13
ENSDART00000125620   None 449 None 12

The following transcripts of ENSDARG00000009585 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 4755638)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4671005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCCTCCCAAGCAACCCCATCCCTGTGGTCAAGAATTCGATCAAGCTC[C/T]GACTCAGCAGGTAGAAGCGGCCCAGTCTTCAGCTCGTCTCAATCTCAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link