LOC100334180

Ensembl ID:
ENSDARG00000009582
Human Orthologue:
ABCC6
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Mouse Orthologue:
Abcc6
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1351634]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38401 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11801 Nonsense Available for shipment Available now
sa989 Essential Splice Site Available for shipment Available now
sa15585 Essential Splice Site Available for shipment Available now
sa33240 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042812 Essential Splice Site 73 1527 2 33
Genomic Location (Zv9):
Chromosome 3 (position 36417565)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36616825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGACAATGGACGCATATCTATATCCAGCCTCTGCTGTGCCAAGACG[G/A]TGAGTCATTTCAGTCATATCAAGACTTGCATTCTAGTTATCATCCCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042812 Nonsense 96 1527 3 33
Genomic Location (Zv9):
Chromosome 3 (position 36418649)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36615741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCTCCTTTGGTTTTCTGGAGAYGGTCTACCTGCTGGYGGAMAGAAGG[A/T]GAGACATAGAGCATCACATGGTCTTTCTCCTGAGCCCTATAATCCGCWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042812 Essential Splice Site 405 1527 10 33
Genomic Location (Zv9):
Chromosome 3 (position 36433700)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36676787
KASP Assay ID:
554-0893.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTGGCATGAGGGTTAAAACTGCAGTTATGGGACTGGTGTACCGGAAG[G/A]TAAATCTTNNAAGTGTTTACTARCAAATGCAAAGCAGCATTTAATGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042812 Essential Splice Site 607 1527 14 33
Genomic Location (Zv9):
Chromosome 3 (position 36435720)
KASP Assay ID:
2259-3800.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAGCTCCACTCAGYCAACTGCCATTTGCAATGAGCACTACTATGCAG[G/A]TGAGCACCAGTACTACATGCTCTMTAYATGTTATAATAKTARAGTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042812 Nonsense 1268 1527 28 33
Genomic Location (Zv9):
Chromosome 3 (position 36444644)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36604460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACAACATTGTGTCTGTTGAGCGAGTGAAAGAATATGCTGAAACGGCA[A/T]AAGAGGTAGTGTTGGTCTGAATGCTCTGTTTTTGCCATAAATTCCTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link