LOC568543

Ensembl ID:
ENSDARG00000009568
Human Orthologue:
CA10
Human Description:
carbonic anhydrase X [Source:HGNC Symbol;Acc:1369]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6038 Essential Splice Site Mutation detected in F1 DNA During 2014
sa612 Nonsense Available for shipment Available now
sa20070 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8624 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Essential Splice Site 45 326 3 9
Genomic Location:
Chromosome 3 (position 35035990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGCTGCTGAAATTTAAAGCTGMTGCTCTGAACTTTTTTCATTTTCAT[A/T]GTGCCGTCTTTCTGGGGACTARTTAACACTGCCTGGAATCTGTGCGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Nonsense 85 326 3 9
Genomic Location:
Chromosome 3 (position 35036111)
KASP Assay ID:
554-0522.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACATTGAAACCAGTCGCATGATTTTTGACCCCTTCCTCAACCCGCTA[C/T]GACTCAATGCAGGGCAACGCAAGGTAAGTGGTAAATCAGATGAAGCTCTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Essential Splice Site 93 326 4 9
Genomic Location:
Chromosome 3 (position 35052696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCCAGAAGGCATCTAATCCTAAAAATAAATGTTTGGGTGTGTTTTTC[A/T]GGTCAGTGGAACGATGTATAACACGGGCCGGCATGTGTCACTGCGCCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Nonsense 222 326 7 9
Genomic Location:
Chromosome 3 (position 35061865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAYACTGTCTTTTCAGATGATGCATACTTATTGATGGGGCTGAATATT[G/T]AGGAGCTGTATCCCGAAACCTCACGGTTTATCACTTATGAAGGGTCGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fmmsolmh