si:ch211-195m20.1

Ensembl ID:
ENSDARG00000009567
ZFIN ID:
ZDB-GENE-081104-517
Description:
Novel protein similar to SPEG complex locus (Speg) [Source:UniProtKB/TrEMBL;Acc:B0S5V2]
Human Orthologue:
SPEG
Human Description:
SPEG complex locus [Source:HGNC Symbol;Acc:16901]
Mouse Orthologue:
Speg
Mouse Description:
SPEG complex locus Gene [Source:MGI Symbol;Acc:MGI:109282]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15486 Nonsense Available for shipment Available now
sa10121 Nonsense Available for shipment Available now
sa31739 Nonsense Available for shipment Available now
sa34720 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa15274 Essential Splice Site Available for shipment Available now
sa17142 Nonsense Available for shipment Available now
sa732 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 505 2702 3 31
ENSDART00000138473   None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42688497)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41813667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TASWGGAGGGATACAACAGCAAATTAAWGTATTTTRTATACAGTTATATG[G/A]AAGAAAGACAACACTGAGGTCAAGAACAGTCCCACTCATGTTGTAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 995 2702 11 31
ENSDART00000138473   None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42710308)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41835478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCACAGCCTGGTGGTCCGCTGTGTTTGTCATGCTCACGGAGGGGTTTA[C/A]AAGTGTGTCAKWTCCAATAAAGTGGGCAAGGCCACCTGCTATTCTCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 1057 2702 13 31
ENSDART00000138473   None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42714263)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41839433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTCCAAAAAATCGTATTTATGTTTCCAGACCCCAGCTCCCTGATGTA[T/A]GCCATTCAGCAACAGGCCCTGGGGTCGATCCAGTGGACCATCATCGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Splice Site, Nonsense 1314 2702 18 31
ENSDART00000138473   None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42721597)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41846767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCTGATCAAGCAAATCTTACCCATTTTTGAATTTCTCCACATAGCC[A/T]AACAGTACAAAGACGACCCGATGGAGGATGAGGCGTCCATCCTCAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Essential Splice Site 1413 2702 20 31
ENSDART00000138473   None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42725179)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41850349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGAGTTGATTTTCTCCATCACTGTGATTGTCTTTGACAACATGCAAA[G/A]ATGCCATGAGGAGCTTCTCGATAGGCTTACAAAGAAATCAACCATCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 2270 2702 26 31
ENSDART00000138473   None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42732044)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41857214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTTTCKCATTTCAGAAGACTGAAGACAAGYCYTCCACTGTTTCTCCT[G/T]AAACTGCWGAAGAAMTGTATCRCCCTGGACCAACTGGTGCTCCTTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Essential Splice Site 2512 2702 27 31
ENSDART00000138473   None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42732849)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41858019
KASP Assay ID:
554-0639.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACAGTTTCCCAACCAGACATCCCAGCTTCCATTGCTAGAGAGAATGG[T/C]TCTCTACGRTCTCGCCAATATACACGTCTAACATCTGGTACTGCACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link