foxi3b

Ensembl ID:
ENSDARG00000009550
ZFIN ID:
ZDB-GENE-031126-4
Description:
forkhead box protein I1 [Source:RefSeq peptide;Acc:NP_944600]
Human Orthologue:
FOXI1
Human Description:
forkhead box I1 [Source:HGNC Symbol;Acc:3815]
Mouse Orthologue:
Foxi1
Mouse Description:
forkhead box I1 Gene [Source:MGI Symbol;Acc:MGI:1096329]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22519 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024440 Nonsense 371 383 2 2
Genomic Location:
Chromosome 14 (position 35646411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACCTGTTCTCAGTCAGTTTAATGGCCATTTCTTCCCTGGTTTGAGCT[C/A]AACGGGTATTCTTTACCCTCGGGAAGGCACAGAGGTGTAGGATGGGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ifg32mm3