tnfa

Ensembl ID:
ENSDARG00000009511
ZFIN ID:
ZDB-GENE-050317-1
Description:
tumor necrosis factor, alpha [Source:RefSeq peptide;Acc:NP_998024]
Human Orthologues:
LTA, TNF
Human Descriptions:
lymphotoxin alpha (TNF superfamily, member 1) [Source:HGNC Symbol;Acc:6709]
tumor necrosis factor [Source:HGNC Symbol;Acc:11892]
Mouse Orthologues:
Lta, Tnf
Mouse Descriptions:
lymphotoxin A Gene [Source:MGI Symbol;Acc:MGI:104797]
tumor necrosis factor Gene [Source:MGI Symbol;Acc:MGI:104798]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16250 Essential Splice Site Available for shipment Available now
sa3045 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43296 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025847 Essential Splice Site 68 234 2 4
Genomic Location:
Chromosome 19 (position 27505511)
KASP Assay ID:
2261-3380.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWGKCTCTGTTTCTCTCTCTAGACCCAGGGCAATCAACAAGATGGAAGTG[G/T]WGAGTTTCAAATCTTCTTTGTCAGAGTTAAATCAGGTTATTTTGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025847 Essential Splice Site 69 234 2 4
Genomic Location:
Chromosome 19 (position 27505512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGKCTCTGTTTCTCTCTCTAGACCCAGGGCAATCAACAAGATGGAAGTGG[T/A]GAGTTTCAAATCTTCTTTGTCAGAGTTAAATCAGGTTATTTTGTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025847 Nonsense 140 234 4 4
Genomic Location:
Chromosome 19 (position 27509152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTATCATTCCCGATGATGGCATTTATTTTGTCTACAGCCAGGTGTCTT[T/A]GCACATCAGCTGCACGTCTGAACTGACTGAGGAACAAGTGCTTATGAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • AIDS progression: Genomewide association study of an AIDS-nonprogression cohort emphasizes the role played by HLA genes (ANRS Genomewide Association Study 02). (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Neonatal lupus: Identification of candidate loci at 6p21 and 21q22 in a genome-wide association study of cardiac manifestations of neonatal lupus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link