irx1a

Ensembl ID:
ENSDARG00000009510
ZFIN IDs:
ZDB-GENE-040707-1, ZDB-GENE-040707-1, ZDB-GENE-040707-1
Description:
iroquois-class homeodomain protein IRX-1 isoform 1 [Source:RefSeq peptide;Acc:NP_997067]
Human Orthologue:
IRX1
Human Description:
iroquois homeobox 1 [Source:HGNC Symbol;Acc:14358]
Mouse Orthologue:
Irx1
Mouse Description:
Iroquois related homeobox 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1197515]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24999 Nonsense Mutation detected in F1 DNA During 2014
sa15451 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa24999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006726 Nonsense 8 426 1 4
ENSDART00000044190 Nonsense 8 419 1 3
ENSDART00000082371 Nonsense 8 148 1 6
Genomic Location:
Chromosome 16 (position 820834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTGGCTTCCGACGTGGCGGAGGAGATGTCTTTCCCCCAGCTGGGCTA[C/A]CCGCAGTATTTAAGTGCCTCCCAGGCGGTGTACGGAGGCGACCGACCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006726 Missense 406 426 3 4
ENSDART00000044190 None None 419 None 3
ENSDART00000082371 Essential Splice Site 119 148 3 6
Genomic Location:
Chromosome 16 (position 823481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAATGAATCRCCAACGCAACCTTTAAAGTCGTCGTTTCGTCCTCTTCA[T/A]GACAGGTAAATGTGCAYTATWCTCTCAGTTTTCCCTCCTCCTTCTTCATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ak6wk6jf