Q5RHP7_DANRE

Ensembl ID:
ENSDARG00000009499
Description:
Novel protein similar to vertebrate spectrin repeat containing, nuclear envelope 1 (SYNE1) [Source:U
Human Orthologue:
SYNE1
Human Description:
spectrin repeat containing, nuclear envelope 1 [Source:HGNC Symbol;Acc:17089]
Mouse Orthologue:
Syne1
Mouse Description:
synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]

Alleles

There are 17 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1308 Nonsense Available for shipment Available now
sa10861 Nonsense Available for shipment Available now
sa19236 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9580 Nonsense Available for shipment Available now
sa25138 Nonsense Mutation detected in F1 DNA During 2017
sa1586 Nonsense Available for shipment Available now
sa1036 Essential Splice Site F2 line generated During 2017
sa23714 Nonsense Available for shipment Available now
sa43447 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43448 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37039 Nonsense Available for shipment Available now
sa23715 Essential Splice Site, Splice Site Available for shipment Available now
sa16694 Nonsense Available for shipment Available now
sa10996 Nonsense Available for shipment Available now
sa32293 Nonsense Available for shipment Available now
sa37040 Nonsense Mutation detected in F1 DNA During 2017
sa23716 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820   None 2829 None 54
ENSDART00000139350 Nonsense 4442 7320 61 114
Genomic Location (Zv9):
Chromosome 20 (position 26342115)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26413418
KASP Assay ID:
554-1223.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCAGACACTCTCAATGACASGATGTAATGTGTTTGTAGGGTTCAGGA[C/T]GAGCTCCTTTAAGTAGAGCTCCATTACAGGAGCTTTATGACCCTTCCATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820   None 2829 None 54
ENSDART00000139350 Nonsense 4484 7320 62 114
Genomic Location (Zv9):
Chromosome 20 (position 26343211)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26414514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATTACTGATGTGTGGTCTGACATATTTCTGTACAGATCAGCGAGAAG[C/T]AGAAAAGCCTGTATGAAGCACTGGAGAGGCAGCAGCACTACCAGGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Essential Splice Site 21 2829 None 54
ENSDART00000139350 Essential Splice Site 4533 7320 None 114
Genomic Location (Zv9):
Chromosome 20 (position 26343362)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26414665
KASP Assay ID:
2261-4371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTTAGAGCCAAGCAAGAGTCCTGAGAGCCAGATGGCCGCCCACCAGG[T/C]GAGAAAAACACTGGATCGGATGAAGCAAGATGACCGCACTAAAGCTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 158 2829 4 54
ENSDART00000139350 Nonsense 4670 7320 65 114
Genomic Location (Zv9):
Chromosome 20 (position 26347061)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26418364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTCCTGTTCAAGAACATGTTACTGGAGATYGAGCAGAAGGTGTYGTG[T/A]CTGTCTGAGCTGTCCGTGCACAGTGAGAGTTTGCTGTTGGMGGKTAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 691 2829 14 54
ENSDART00000139350 Nonsense 5200 7320 75 114
Genomic Location (Zv9):
Chromosome 20 (position 26352731)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26424034
KASP Assay ID:
554-7647.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTCAGAGCCTGGAAGAGACTGTGGCTCAGGCACAAGCTGTACTTAAA[C/T]AGGCCCATAAACGAGGAGTGGAACTAGAGGGCATCCTGGAGGTGCGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 821 2829 17 54
ENSDART00000139350 Nonsense 5328 7320 78 114
Genomic Location (Zv9):
Chromosome 20 (position 26353519)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26424822
KASP Assay ID:
554-1528.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGAAATCACATAACGTCTTTGTATTTTATTTCAGGTATCAGAGTGAAT[C/A]AGCTGAGCTTAGCCAATGGCTGAGTTCGGCTCTTGACCGTCTGGAGTTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1036
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Essential Splice Site 971 2829 19 54
ENSDART00000139350 Essential Splice Site 5478 7320 80 114
Genomic Location (Zv9):
Chromosome 20 (position 26355120)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26426423
KASP Assay ID:
554-0939.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGGCTGTGGGCTCTGWGGTTGTCCAAAYGTACCTTCAGAAATACAAG[G/A]TAAGTAAAAACCTGCARGAACATGAAATAAACCTTTTGTTTTCAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 1020 2829 20 54
ENSDART00000139350 Nonsense 5527 7320 81 114
Genomic Location (Zv9):
Chromosome 20 (position 26355351)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26426654
KASP Assay ID:
2261-4376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACAAAACAGACTTCGCTGAGCGTCTTGGTGCCATGAACCGCCGCTG[G/A]CAGATATTGCAGGGACTTGTTACAGAGAAGGTTAGATATAAATAGTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Essential Splice Site 1082 2829 21 54
ENSDART00000139350 Essential Splice Site 5589 7320 82 114
Genomic Location (Zv9):
Chromosome 20 (position 26355779)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26427082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGATTGAGGATGTTTCCTCTGCTCAGAATGCACTGAAAGACTGTCAG[G/A]TAAGCACCACGCCAACAAAATATTACACAGACAATGCAGAAATTTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Essential Splice Site 1415 2829 28 54
ENSDART00000139350 Essential Splice Site 5915 7320 89 114
Genomic Location (Zv9):
Chromosome 20 (position 26358842)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26430145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTCTTAAAGGCTGTAATCTGAACATTCTCATGTGCATGTGTTTATA[G/T]ACTCAATTATTAAAGCTGAGCAGTCTTTCTCCTGATCTGGAGCGTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 1671 2829 32 54
ENSDART00000139350 Nonsense 6171 7320 93 114
Genomic Location (Zv9):
Chromosome 20 (position 26361326)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26432629
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGCAGAGGCATCGCTTCACACTGAGCTCACAGACGTCCAGGAGCGCT[G/A]GAGGGCCATTAACATCCGCCTCGATGAGAGGAAGAAAGAGCTGCTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Essential Splice Site 1893 2829 37 54
ENSDART00000139350 Splice Site None 7320 None 114
Genomic Location (Zv9):
Chromosome 20 (position 26372360)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26443663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTGCTGTTGATGTTAACAGTGTGTTAACTCTGTTTTCTTTTTTTTCT[G/A]TAGGGTGAAGAAGTTGAGGGAGACGCTGGTGGCCGTGCAGCAGCTGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 2315 2829 43 54
ENSDART00000139350 Nonsense 6814 7320 104 114
Genomic Location (Zv9):
Chromosome 20 (position 26378665)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26449968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGATTATGACCTGGAGCCMATGAGCCACACCATGTCTGMAGAGCGGGKC[A/T]GACAGAAAGATGAGGATGAGGATTTGCTGTGTATGGCWACTGYAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 2457 2829 48 54
ENSDART00000139350 Nonsense 6948 7320 108 114
Genomic Location (Zv9):
Chromosome 20 (position 26381438)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26452741
KASP Assay ID:
2261-4382.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGTGATCGAGCGCTGGGAACTGATCCAGGCTCAGTCTGGAGATTTA[G/T]AGCACAGACAGACTGAAGACCTGCTGCTCTGGCAACAGATAACCTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 2468 2829 48 54
ENSDART00000139350 Nonsense 6959 7320 108 114
Genomic Location (Zv9):
Chromosome 20 (position 26381471)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26452774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGTCTGGAGATTTAGAGCACAGACAGACTGAAGACCTGCTGCTCTGG[C/T]AACAGATAACCTCTGACCTGGAGGACATGGAGGCATGGCTTGAAGAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Nonsense 2638 2829 51 54
ENSDART00000139350 Nonsense 7129 7320 111 114
Genomic Location (Zv9):
Chromosome 20 (position 26385222)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26456525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAATCCAGCGTGAACTGACGGAGACGGAGCAGAAAGTGGATGGTCTG[C/T]AGGAGCTCTCAGGTCAGCTGCTGGTACAGGCTCATGGCAACGAGTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015820 Essential Splice Site 2723 2829 52 54
ENSDART00000139350 Essential Splice Site 7214 7320 112 114
Genomic Location (Zv9):
Chromosome 20 (position 26385902)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26457205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGGTCAGTCCTGTTTCAGAGGTCAGCGTTTCCACTAAACGACAATCGG[T/C]AATGCACCTCCTCCATTTTTTTCTTATTATTTCAGGCATGGTGTGAAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link