si:ch211-45c16.2

Ensembl ID:
ENSDARG00000009493
ZFIN ID:
ZDB-GENE-081105-15
Human Orthologue:
MAP3K13
Human Description:
mitogen-activated protein kinase kinase kinase 13 [Source:HGNC Symbol;Acc:6852]
Mouse Orthologue:
Map3k13
Mouse Description:
mitogen-activated protein kinase kinase kinase 13 Gene [Source:MGI Symbol;Acc:MGI:2444243]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13481 Nonsense Available for shipment Available now
sa17143 Essential Splice Site Available for shipment Available now
sa13787 Essential Splice Site Available for shipment Available now
sa13451 Nonsense Available for shipment Available now
sa34779 Nonsense Mutation detected in F1 DNA During 2017
sa15617 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007401 Nonsense 208 981 1 14
ENSDART00000140771 Nonsense 208 981 3 16
Genomic Location (Zv9):
Chromosome 9 (position 54351885)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53195051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTGGAATATCATTGGGAAGACATATTCAACCGAGTAYAAGCTTCAA[C/T]AGCAAGGTTAGTGGAGTCTGGGAAGTGCCAGATTAAKTATAMATTACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007401 Essential Splice Site 388 981 4 14
ENSDART00000140771 Essential Splice Site 388 981 6 16
Genomic Location (Zv9):
Chromosome 9 (position 54340378)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53183544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGAAGTCATCCGGAATGAGCCGGTGTCTGAGAAAGTAGACATCTGG[T/C]GAGTGTGGATTAATGCRGSRTCATTCAGTGAGATTTAAGTGTCTGGAKWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007401 Essential Splice Site 477 981 6 14
ENSDART00000140771 Essential Splice Site 477 981 8 16
Genomic Location (Zv9):
Chromosome 9 (position 54336056)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53179222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCGCTGATGTGCTTGGGACGCCACAGGAGACCTACTTCAAATGYCAG[G/A]TCAGAAAAACACANNNNNNNNNNNNTGAGATTCATYTGCAAACCACTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007401 Nonsense 489 981 7 14
ENSDART00000140771 Nonsense 489 981 9 16
Genomic Location (Zv9):
Chromosome 9 (position 54333186)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53176352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATAATCTGTGACAGACGGAGTGGMGAGAGGAGGTGAAGAAAYATTTC[G/T]AGAAGATCAAGAGTGAAGGCACATGCATCCATCGGCKGGACGAGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007401 Nonsense 543 981 8 14
ENSDART00000140771 Nonsense 543 981 10 16
Genomic Location (Zv9):
Chromosome 9 (position 54332838)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53176004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGAGCGGGCCAATAATCTGTACATGGAGCTCAGCGCTATCATGCTA[C/T]AGCTGGAGGTGCGCGAGAAAGAGCTGCTCAAGTGAGTTCCTCAAGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007401 Nonsense 562 981 9 14
ENSDART00000140771 Nonsense 562 981 11 16
Genomic Location (Zv9):
Chromosome 9 (position 54328824)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53171990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTTACATGTGTTTTCTGCAGGAGGGAGCAGGCCGTGGAGAAGAAGTA[T/A]CCGGGAACGTACAAACGCCACTTGGTTCGGCCCATTGTGCGACCCAATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link