NP_001138287.1

Ensembl ID:
ENSDARG00000009482
Description:
solute carrier family 38, member 8 [Source:RefSeq peptide;Acc:NP_001138287]
Human Orthologue:
SLC38A8
Human Description:
solute carrier family 38, member 8 [Source:HGNC Symbol;Acc:32434]
Mouse Orthologue:
Slc38a8
Mouse Description:
solute carrier family 38, member 8 Gene [Source:MGI Symbol;Acc:MGI:2685433]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23296 Essential Splice Site Available for shipment Available now
sa16369 Nonsense Available for shipment Available now
sa16166 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Essential Splice Site 274 441 6 11
Genomic Location (Zv9):
Chromosome 18 (position 21410554)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21640777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCGGTGTTGTCCATGCTCATCTGCCTGCTCATCTACTCGCTCACAG[G/A]TCAGTAATGATCATATACTGAAACACAAAGATTGCTTTTAATCAAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Nonsense 311 441 7 11
ENSDART00000100857 Nonsense 311 441 7 11
Genomic Location (Zv9):
Chromosome 18 (position 21406154)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21636377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAGTGGTGGTGATGTCACCATGAKTGTCGCCAGGCTTCTGTTTGGAATCT[C/A]AATTATCACCATCTACCCCATCATCGTCCTGCTTGGAAGGTCTGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Nonsense 311 441 7 11
ENSDART00000100857 Nonsense 311 441 7 11
Genomic Location (Zv9):
Chromosome 18 (position 21406154)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21636377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAGTGGTGGTGATGTCACCATGAKTGTCGCCAGGCTTCTGTTTGGAATCT[C/A]AATTATCACCATCTACCCCATCATCGTCCTGCTTGGAAGGTCTGAAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link