ppardb

Ensembl ID:
ENSDARG00000009473
ZFIN ID:
ZDB-GENE-000112-47
Description:
peroxisome proliferator-activated receptor delta b [Source:RefSeq peptide;Acc:NP_571543]
Human Orthologue:
PPARD
Human Description:
peroxisome proliferator-activated receptor delta [Source:HGNC Symbol;Acc:9235]
Mouse Orthologue:
Ppard
Mouse Description:
peroxisome proliferator activator receptor delta Gene [Source:MGI Symbol;Acc:MGI:101884]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34394 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41198 Nonsense Mutation detected in F1 DNA During 2017
sa2434 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa34394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013214 Essential Splice Site 24 367 3 7
ENSDART00000128783 Essential Splice Site 174 517 3 7
ENSDART00000132584 Essential Splice Site 174 517 4 8
ENSDART00000135394 Essential Splice Site 174 219 4 4
ENSDART00000141099   None 120 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24567850)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23693668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCATGTGTGCCTTTCCGTTTTTCAGTGAGGATGTCATTTGTGTTTAAA[G/A]GGTTTTTTCAGGCGCACCATTCGTATGAAGTTGGAGTACGAGCGATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013214 Nonsense 36 367 3 7
ENSDART00000128783 Nonsense 186 517 3 7
ENSDART00000132584 Nonsense 186 517 4 8
ENSDART00000135394 Nonsense 186 219 4 4
ENSDART00000141099   None 120 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24567889)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23693707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTAAAGGGTTTTTTCAGGCGCACCATTCGTATGAAGTTGGAGTA[C/A]GAGCGATGTGAGCGCGCCTGTAAAGTCCAGAAAAAGAGCCGGAACAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2434
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013214 Nonsense 248 367 6 7
ENSDART00000128783 Nonsense 398 517 6 7
ENSDART00000132584 Nonsense 398 517 7 8
ENSDART00000135394   None 219 None 4
ENSDART00000141099   None 120 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24573570)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23699388
KASP Assay ID:
554-2941.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCAATGGGAAGGGTTTTGTGACGAGAGAGTTTCTGCGAAGTTTACGC[A/T]AGCCATTCAGTGAGATCATGGAGCCCAAGTTTGAGTTTGCAGTGAAATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link