med19b

Ensembl ID:
ENSDARG00000009472
ZFIN ID:
ZDB-GENE-040727-4
Description:
Mediator of RNA polymerase II transcription subunit 19-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DRL8]
Human Orthologue:
MED19
Human Description:
mediator complex subunit 19 [Source:HGNC Symbol;Acc:29600]
Mouse Orthologue:
Med19
Mouse Description:
mediator of RNA polymerase II transcription, subunit 19 homolog (yeast) Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003022 Essential Splice Site 156 240 4 6
ENSDART00000137980 None 174 259 4 6
Genomic Location:
Chromosome 1 (position 45042478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGANTTTTTTGTGTATGTTTTATCTGACTCTATGTCTGTCTTGCTGAA[G/A]TTACCAGAGCARTACAGACTGATGCACATTCAGCCGCCTAAGAAGAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fm7bxhqs